Effects of narrow‐band UVB on nasal symptom and upregulation of histamine H1 receptor mRNA in allergic rhinitis model rats (2024)

Background

Phototherapy with narrow‐band ultraviolet B (narrow‐band UVB) is clinically effective treatment for atopic dermatitis. In the present study, we examined the effects of intranasal irradiation with narrow‐band UVB on nasal symptom, upregulation of histamine H₁ receptor (H1R) gene expression and induction of DNA damage in the nasal mucosa of allergic rhinitis (AR) model rat.

Methods

AR model rats were intranasally irradiated with 310 nm of narrow‐band UVB. Nasal mucosal levels of H1R mRNA were measured using real‐time quantitative reverse transcriptase (RT)‐PCR. DNA damage was evaluated using cyclobutane pyrimidine dimer (CPD) immunostaining.

Results

In toluene 2,4‐diisocyanate (TDI)‐sensitized rats, TDI provoked sneezes and H1R gene expression in the nasal mucosa. Intranasal pre‐irradiation with 310 nm narrow‐band UVB at doses of 600 and 1400, but not 200 mJ/cm² significantly inhibited the number of sneezes and upregulation of H1R gene expression provoked by TDI. CPD‐positive cells appeared in the nasal mucosa after intranasal narrow‐band UVB irradiation at a dose of 1400, but not 200 and 600 mJ/cm². The suppression of TDI‐provoked sneezes and upregulation of H1R gene expression lasted 24 hours, but not 48 hours, after narrow‐band UVB irradiation with a dose of 600 mJ/cm².

Conclusions

Intranasal pre‐irradiation with narrow‐band UVB dose‐dependently inhibited sneezes and upregulation of H1R gene expression of the nasal mucosa in AR model rats, suggesting that the inhibition of nasal upregulation of H1R gene expression suppressed nasal symptom. The suppression after narrow‐band UVB irradiation at a dose of 600 mJ/cm² was reversible without induction of DNA damage. These findings indicated that low‐dose narrow‐band UVB phototherapy could be effectively and safely used for AR treatment in a clinical setting.

Level of Evidence

NA.

Keywords: allergic rhinitis, apoptosis, histamine H₁ receptor, narrow‐band ultraviolet B, phototherapy

2.1. Animals

Brown Norway rats (male, six‐week‐old, 200‐250 g, Japan SLC, Hamamatsu, Japan) were used for this study. Rats were allowed free access to water and food. Room temperature and humidity were maintained at 25 ± 2°C and 55 ± 10%, respectively, with a 12‐hours light/dark cycle. Rats sensitization and provocation with TDI were performed by technique described by Nurul et al.9 Briefly, 10 μL of a 10% solution of TDI in ethyl acetate (Wako Pure Chemical, Osaka, Japan) was applied bilaterally to the rats nasal vestibule once a day for 5 days (days 1‐5). After a 2‐days interval, the sensitization procedure was repeated (days 8‐12). Nine days after the second sensitization, 10 μL of TDI solution was applied to the nasal vestibule again to provoke nasal symptom in TDI‐sensitized rats (Figure 1). Control rats were treated with ethyl acetate using the same procedure. Immediately after TDI provocation, the number of sneezes was counted for 10 minutes. The nasal septum mucosa was dissected 4 hours after TDI provocation. Samples were stocked in RNAlater (Thermo Fisher Scientific, Waltham, Massachusetts) at −80°C until assayed. We performed all experimental procedures in accordance with the guidelines and approval of the Animal Research Committee of Tokushima University.

2.2. Narrow‐band UVB irradiation

An LED that emits its energy mostly at 310 nm wavelength, within the narrow‐band UVB (Nichia Corporation, Tokushima, Japan), was used for intranasal irradiation through the bilateral nostrils of TDI‐sensitized rats on day 22. An UVX Radiometer (UVP, Upland, California) was used to measure the dosages of narrow‐band UVB. The distance between the sensor of the UVB meter and the tip of the probe, where the LED was embedded, was 5 mm, that was the same as the distance from the rats nostrils to nasal mucosa. Two probes were placed in front of each rat nostril and adjusted 30° angle outside to the body axis. Narrow‐band UVB at 310 nm was used to irradiate rat nostrils at doses of 200, 600, and 1400 mJ/cm² under anesthesia with pentobarbital with a dose of 30 mg/kg, intraperitoneally. Three hours after irradiation, we applied TDI to nasal vestibule bilaterally to provoke nasal symptom (Figure 1).

2.3. Real‐time quantitative reverse transcriptase (RT)‐PCR

We homogenized nasal mucosa samples using a polytron homogenizer (PT‐K; Kinematica, AG, Luzern, Switzerland). We then isolated total RNA using the RNAiso Plus reagent (Takara Bio Inc., Kyoto, Japan). RNA samples were reverse transcribed to cDNA using a PrimeScript RT Reagent Kit (Takara Bio Inc., Shiga, Japan). TaqMan primers and the probe were designed using Primer Express Software (Applied Biosystems, Foster City, CA, USA) as follows: forward primer for rat H1R, 5′‐TATGTGTCCGGGCTGCACT‐3′; reverse primer for rat H1R, 5′‐CGCCATGATAAAACCCAACTG‐3′; and TaqMan probe, FAM‐CCGAGAGCGGAAGGCAGCCA‐TAMURA. To standardize the starting material, endogenous rodent GAPDH control reagents (Applied Biosystems) were used, and we expressed data as a ratio of GAPDH mRNA.

2.4. Induction of apoptosis evaluated by TdT‐mediated dUTP nick end labeling (TUNEL) staining

Narrow‐band UVB‐induced apoptosis in the nasal mucosa cells was detected by TUNEL staining in TDI‐sensitized rats. Three hours after narrow‐band UVB irradiation with doses of 200, 600 and 1400 mJ/cm², we applied TDI to the nasal vestibule to provoke nasal symptom. Four hours after provocation, we dissected and fixed the nasal mucosa in 4% paraformaldehyde for approximately 24 hours, washed in phosphate buffered saline (PBS), and transferred to 30% sucrose for cryoprotection. The nasal mucosa was embedded in optimal cutting temperature (OCT) compound (Tissue‐Tek; Sakura Fine Technical, Tokyo, Japan), rapidly frozen on dry ice, and then cut into 10 μm‐thick sections using a cryostat (CM3050s; Leica Instrument, Nussloch, Germany). The TUNEL staining was performed by using the DeadEnd Fluorometric TUNEL System (Promega, Madison, Wisconsin). The tissue sections on a glass slide were dried, washed in PBS to remove the OCT compound, incubated with 20 μg/mL Proteinase K for 10 minutes at 25°C, washed in PBS for 5 minutes, and immersed in 4% paraformaldehyde for 5 minutes. They were then washed in PBS for 5 minutes, immersed in 0.2% Triton‐X100 for 5 minutes, and washed in PBS for 5 minutes. Equilibration Buffer (100 μL) was added to the tissue sections and incubated for 10 minutes at 25°C. The TdT reaction mixture (50 μL) was added to the tissue sections and incubated for 60 minutes at 37°C in a humidified chamber. The tissue sections were then immersed in 2× saline sodium citrate (SSC) for 15 minutes 25°C, washed in PBS three times for 5 minutes each, counterstained with 1 μg/mL propidium iodide for 15 minutes, and washed in PBS three times for 5 minutes each. Thereafter, the tissue sections were observed using a fluorescent microscope (BZ‐X710; Keyence, Osaka, Japan). As a positive control, the tissue sections dissected from control rats were treated with RQ1 RNase‐Free DNase (Promega). Before the equilibration buffer was added, 500 μL RQ1 DNase reaction buffer was added to the tissue sections and incubated for 5 minutes at 25°C. After the tissue sections were dried, 10 u/mL RQ1 RNase‐Free DNase was added to the tissue sections and incubated for 10 minutes at 25°C. The tissue sections were washed in PBS, and then the TUNEL reaction was performed the same as described above.

2.5. DNA damage evaluated by cyclobutane pyrimidine dimer (CPD) immunostaining

Narrow‐band UVB‐induced DNA damage in nasal mucosa cells was detected by using CPD immunostaining in TDI‐sensitized rats. Three hours after narrow‐band UVB irradiation at doses of 200, 600, and 1400 mJ/cm², we applied TDI to the nasal vestibule to provoke nasal symptom. Four hours after provocation, we dissected the nasal mucosa, then fixed in 4% paraformaldehyde for approximately 24 hours, washed in PBS, and transferred to 30% sucrose for cryoprotection. The nasal mucosa was embedded in OCT compound (Tissue‐Tek; Sakura Fine Technical, Tokyo, Japan), rapidly frozen on dry ice, and then cut into 10 μm‐thick sections using a cryostat (CM3050s; Leica Instrument, Nussloch, Germany). The tissue sections on a glass slide were dried, washed in PBS‐Tween (PBST) to remove the OCT compound, and subsequently boiled at 85°C in 10 mM citric acid solution for 10 minutes. The tissue sections were incubated on ice for 1 hour, washed in PBST for 5 minutes, blocked for 1 hour at 25°C in a solution of 3% goat serum in PBST, and then incubated with anti‐CPD antibody (Cosmo Bio Co., Ltd., Tokyo, Japan) diluted 1:400 in PBST at 4°C overnight. Finally, the tissue sections were incubated with secondary antibody, fluorescein isothiocyanate (FITC)‐conjugated anti‐mouse IgG antibody (Jackson ImmunoResearch, West Grove, Pennsylvania) diluted 1:400 in PBST at 25°C for 2 hours, counterstained with 1 μg/mL propidium iodide for 15 minutes, and washed in PBST three times for 5 minutes each. Thereafter, the tissue sections were observed using a fluorescent microscope (BZ‐X710; Keyence, Osaka, Japan).

2.6. Time course after narrow‐band UVB irradiation

We used 310 nm of narrow‐band UVB at a dose of 600 mJ/cm² to intranasally irradiate TDI‐sensitized rats, and TDI provocation was performed 3, 24, and 48 hours later on day 22 (Figure 1). We counted the number of sneezes for 10 minutes, then dissected the nasal mucosa 4 hours after provocation, and samples were stored as described above. Nasal mucosa levels of H1R mRNA were measured using real‐time quantitative RT‐PCR, as described above.

We detected narrow‐band UVB‐induced apoptosis and DNA damage in nasal mucosa cells using TUNEL staining and CPD immunostaining, respectively, as described above.

2.7. Statistical analysis

The results are presented as the mean ± SEM. Statistical analyses were performed using analysis of variance with Dunnett's test using the GraphPad Prism software (GraphPad Software Inc., La Jolla, California). P values less than .05 were considered statistically significant.

3.1. Effect of narrow‐band UVB irradiation on TDI‐induced upregulation of H1R mRNA of the nasal mucosa and sneezes of TDI‐sensitized rats

In TDI‐sensitized rats, TDI provocation significantly increased H1R mRNA levels in the nasal mucosa. Intranasal pre‐irradiation with narrow‐band UVB with doses of 600 and 1400, but not 200 mJ/cm² significantly inhibited TDI‐provoked H1R mRNA upregulation (Figure 2A). TDI provocation significantly increased the number of sneezes in TDI‐sensitized rats. Intranasal pre‐irradiation with narrow‐band UVB with doses of 600 and 1400, but not 200 mJ/cm² significantly inhibited the number of TDI‐induced sneezes of TDI‐sensitized rats (Figure 2B).

3.2. Induction of apoptosis after narrow‐band UVB irradiation in nasal mucosa cells of TDI‐sensitized rats

After intranasal narrow‐band UVB irradiation with a dose of 200 mJ/cm², no TUNEL‐positive cells appeared in the nasal mucosa of TDI‐sensitized rats. However, after intranasal narrow‐band UVB irradiation with doses of 600 and 1400 mJ/cm², a few and some TUNEL‐positive cells appeared in the nasal mucosa, respectively (Figure 3).

3.3. Induction of DNA damage after narrow‐band UVB irradiation in nasal mucosa cells of TDI‐sensitized rats

After intranasal narrow‐band UVB irradiation at doses of 200 and 600 mJ/cm², no CPD‐positive cells appeared in the nasal mucosa of TDI‐sensitized rats. Meanwhile, after intranasal narrow‐band UVB irradiation at a dose of 1400 mJ/cm², many CPD‐positive cells appeared in the nasal mucosa (Figure 4).

3.4. Time course after narrow‐band UVB irradiation

Intranasal narrow‐band UVB pre‐irradiation at a dose of 600 mJ/cm² significantly inhibited TDI‐provoked sneezes and upregulation of H1R gene expression 3 and 24 hours, but not 48 hours, after irradiation (Figure 5). A few TUNEL‐positive cells appeared in the nasal mucosa 3 hours, but not 24 and 48 hours, after narrow‐band UVB irradiation at a dose of 600 mJ/cm² (Figure 6A). No CPD‐positive cells appeared in the nasal mucosa 3, 24, and 48 hours after narrow‐band UVB irradiation at a dose of 600 mJ/cm² (Figure 6B).

• 1.Katayama I, Aihara M, Ohya Y, et al. Japanese guidelines for atopic dermatitis 2017. Allergol Int. 2017;66:230‐247. [DOI] [PubMed] [Google Scholar]
• 2.Archier E, Devaux S, Castela E, et al. Efficacy of psoralen UV‐A therapy vs. narrowband UV‐B therapy in chronic plaque psoriasis: a systematic literature review. J Eur Acad Dermatol Venereol. 2012;26:11‐21. [DOI] [PubMed] [Google Scholar]
• 3.Sidbury R, Davis DM, Cohen DE, et al. Guidelines of care for the management of atopic dermatitis: section 3. Management and treatment with phototherapy and systemic agents. J Am Acad Dermatol. 2014;71:327‐349. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 4.Kitamura Y, Mizuguchi H, Okamoto K, et al. Irradiation with narrowband‐ultraviolet B suppresses phorbol ester‐induced up‐regulation of H1 receptor mRNA in HeLa cells. Acta Otolaryngol. 2016;136:409‐413. [DOI] [PubMed] [Google Scholar]
• 5.Bousquet J, Khaltaev N, Cruz AA, et al. Allergic rhinitis and its impact on asthma (ARIA) 2008 update (in collaboration with the World Health Organization, GA[2]LEN and AllerGen). Allergy. 2008;63(suppl 86):8‐160. [DOI] [PubMed] [Google Scholar]
• 6.Iriyoshi N, Takeuchi K, Yuta A, Ukai K, Sakakura Y. Increased expression of histamine H1 receptor mRNA in allergic rhinitis. Clin Exp Allergy. 1996;26:379‐385. [PubMed] [Google Scholar]
• 7.Dinh QT, Cryer A, Dinh S, et al. Transcriptional up‐regulation of histamine receptor‐1 in epithelial, mucus and inflammatory cells in perennial allergic rhinitis. Clin Exp Allergy. 2005;35:1443‐1448. [DOI] [PubMed] [Google Scholar]
• 8.Mizuguchi H, Kitamura Y, Kondo Y, et al. Preseasonal prophylactic treatment with antihistamines suppresses nasal symptoms and expression of histamine H1 receptor mRNA in the nasal mucosa of patients with pollinosis. Methods Find Exp Clin Pharmacol. 2010;32:745‐748. [DOI] [PubMed] [Google Scholar]
• 9.Nurul IM, Mizuguchi H, Shahriar M, et al. Albizia lebbeck suppresses histamine signaling by the inhibition of histamine H1 receptor and histidine decarboxylase gene transcriptions. Int Immunopharmacol. 2011;11:1766‐1772. [DOI] [PubMed] [Google Scholar]
• 10.Das AK, Mizuguchi H, Kodama M, et al. Sho‐seiryu‐to suppresses histamine signaling at the transcriptional level in TDI‐sensitized nasal allergy model rats. Allergol Int. 2009;58:81‐88. [DOI] [PubMed] [Google Scholar]
• 11.Matsushita C, Mizuguchi H, Niino H, Sagesaka Y, Masuyama K, Fukui H. Identification of epigallocatechin‐3‐O‐gallate as an active constituent in tea extract that suppresses transcriptional up‐regulations of the histamine H₁ receptor and interleukin‐4 genes. J Trad Med. 2008;25:133‐142. [Google Scholar]
• 12.Islam R, Mizuguchi H, Shaha A, et al. Effect of wild grape on the signaling of histamine H₁ receptor gene expression responsible for the pathogenesis of allergic rhinitis. J Med Invest. 2018;65:242‐250. [DOI] [PubMed] [Google Scholar]
• 13.Aurpita S, Mizuguchi H, Kitamura Y, et al. Effect of royal jelly and Brazilian green propolis on the signaling for histamine H₁ receptor and interleukin‐9 gene expressions responsible for the pathogenesis of the allergic rhinitis. Biol Pharm Bull. 2018;41:1440‐1447. [DOI] [PubMed] [Google Scholar]
• 14.Kitamura Y, Miyoshi A, Murata Y, et al. Effect of glucocorticoid on upregulation of histamine H1 receptor mRNA in nasal mucosa of rats sensitized by exposure to toluene diisocyanate. Acta Otolaryngol. 2004;124:1053‐1058. [DOI] [PubMed] [Google Scholar]
• 15.Mizuguchi H, Terao T, Kitai M, et al. Involvement of protein kinase Cδ/extracellular signal‐regulated kinase/poly (ADP‐ribose) polymerase‐1 (PARP‐1) signaling pathway in histamine‐induced up‐regulation of histamine H1 receptor gene expression in HeLa cells. J Biol Chem. 2011;286:30542‐30551. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 16.Fujii T, Kitamura Y, Mizuguchi H, et al. Effect of irradiation with narrowband‐ultraviolet B on up‐regulation of histamine H1 receptor mRNA and induction of apoptosis in HeLa cells and nasal mucosa of rats. J Pharmacol Sci. 2018;138:54‐62. [DOI] [PubMed] [Google Scholar]
• 17.White MV, Kaliner MA. Mediators of allergic rhinitis. J Allergy Clin Immunol. 1992;90:699‐704. [DOI] [PubMed] [Google Scholar]
• 18.Nakaya M, Takeuchi N, Kondo K. Immunohistochemical localization of histamine receptor subtypes in human inferior turbinates. Ann Otol Rhinol Laryngol. 2004;113:552‐557. [DOI] [PubMed] [Google Scholar]
• 19.Koreck AI, Csoma Z, Bodai L, et al. Rhinophototherapy: a new therapeutic tool for the management of allergic rhinitis. J Allergy Clin Immunol. 2005;115:541‐547. [DOI] [PubMed] [Google Scholar]
• 20.Bella Z, Kiricsi A, Viharosne ED, et al. Rhinophototherapy in persistent allergic rhinitis. Eur Arch Otorhinolaryngol. 2017;274:1543‐1550. [DOI] [PubMed] [Google Scholar]
• 21.Ikehata H, Ono T. The mechanisms of UV mutagenesis. J Radiat Res. 2011;52:115‐125. [DOI] [PubMed] [Google Scholar]
• 22.Cadet J, Douki T. Formation of UV‐induced DNA damage contributing to skin cancer development. Photochem Photobiol Sci. 2018;17:1816‐1841. [DOI] [PubMed] [Google Scholar]
• 23.Kulms D, Schwarz T. Independent contribution of three different pathways to ultraviolet‐B‐induced apoptosis. Biochem Pharmacol. 2002;64:837‐841. [DOI] [PubMed] [Google Scholar]
• 24.Chang H, Oehrl W, Elsner P, Thiele JJ. The role of H₂O₂ as a mediator of UVB‐induced apoptosis in keratinocytes. Free Radic Res. 2003;37:655‐663. [DOI] [PubMed] [Google Scholar]
• 25.Chan PH. Reactive oxygen radicals in signaling and damage in the ischemic brain. J Cereb Blood Flow Metab. 2001;21:2‐14. [DOI] [PubMed] [Google Scholar]
• 26.Dalton T, Shertzer H, Puga A. Regulation of gene expression by reactive oxygen. Annu Rev Pharmacol Toxicol. 1999;39:67‐101. [DOI] [PubMed] [Google Scholar]
• 27.Mitchell D, Paniker L, Sanchez G, et al. Molecular response of nasal mucosa to therapeutic exposure to broad‐band ultraviolet radiation. J Cell Mol Med. 2010;14:313‐322. [DOI] [PMC free article] [PubMed] [Google Scholar]
• 28.Aufiero BM, Talwar H, Young C, et al. Narrow‐band UVB induces apoptosis in human keratinocytes. J Photochem Photobiol B. 2006;82:132‐139. [DOI] [PubMed] [Google Scholar]
• 29.Matsumura Y, Ananthaswany HN. Toxic effects of ultraviolet radiation on the skin. Toxicol Appl Pharmacol. 2004;195:298‐308. [DOI] [PubMed] [Google Scholar]
• 30.Koreck A, Szechenyi A, Morocz M, et al. Effects of intranasal phototherapy on nasal mucosa in patients with allergic rhinitis. J Photochem Photobiol B. 2007;89:163‐169. [DOI] [PubMed] [Google Scholar]
• 31.Garritsen FM, Brouwer MW, Limpens J, Spuls PL. Photo(chemo)therapy in the management of atopic dermatitis: an updated systematic review with implications for practice and research. Br J Dermatol. 2014;170:501‐513. [DOI] [PubMed] [Google Scholar]
• 32.Rodenbeck DL, Silverberg JI, Silververg NB. Phototherapy for atopic dermatitis. Clin Dermatol. 2016;34:607‐613. [DOI] [PubMed] [Google Scholar]
• 33.Pérez‐Ferriols A. The minimal erythema dose (MED) project: in search of consensus on phototesting. Actas Dermosifiliogr. 2013;104:541‐542. [DOI] [PubMed] [Google Scholar]
• 34.Morita A, Eto T, Torii H, et al. Guidelines for phototherapy of psoriasis. Nihon Hifuka Gakkai Zasshi. 2016;126:1239‐1262. (in Japanese). [Google Scholar]